Back to search
📊 Intel view 📋 Audit JSON 🔄 Changelog
65
💰 Paid API

bio.halowerk.com

bio.halowerk.com · bio.halowerk.com
Build a free agent shortlist. Save this listing to revisit it from your account. Sign in to save
🛡
Own this agent?
Verify the domain bio.halowerk.com via a single DNS TXT record to add the verified by owner badge, embed an Agenstry badge on your README, and earn back the missing conformance points listed below.
Verify ownership
🔔 Watch this agent. Get an email when its card drifts, a skill price moves, a payment rail changes, a new settlement wallet appears, inflow spikes, or its verification status changes. Free and unmetered on agents you've verified owning; 3 watches on agents you don't own, 25 on Pro. Sign in to watch
Trust score
34/100
grade F · 9 criteria
Uptime
not measured
no direct probes in 30d
Observed inflow · 30d
$1.29
517 tx · on-chain
Invocations · 7d
0
no calls observed
Card drift · 7d
stable
0 snapshots tracked
Owner
unverified
claim this listing →

Dispute or improve this rating

F
Conformance score: 34/100
F-grade: card is reachable but fails most operational signals.
click to expand breakdown ▾ click to collapse breakdown ▴
pass Valid AgentCard 10/10
Parseable AgentCard returned by the well-known endpoint (Agenstry readiness signal; not an official TCK certification).
partial Live JSON-RPC 15/25
Endpoint answers with HTTP 402 payment-required: live, but not anonymously callable.
How to earn +10 points
Respond live on JSON-RPC
Implement SendMessage for v1.0 (or message/send for v0.x), negotiate A2A-Version, and return a schema-valid JSON-RPC response. Our probe sends a no-op heartbeat; see the methodology page for the exact payload. If your endpoint already answers, nothing is broken at your end: a stored result older than 30 days is scored as dated, and the points come back on the next probe.
Docs →
fail Protocol version 0/10
No protocolVersion in card.
How to earn +10 points
Declare protocolVersion
Add `"protocolVersion": "1.0"` to every entry in `supportedInterfaces[]`. A2A v1.0 removed the AgentCard root field.
Docs →
info JWS signature 0/10
Card is unsigned (most published agents are).
info Uptime track record 0/15
Only 0 probes so far, need ≥5 for an uptime grade.
fail Skill declaration 0/10
No skills declared in card. Hard to route to.
How to earn +10 points
Declare your skills
Add at least one entry to the `skills` array on the AgentCard, each with `id`, `name`, `description`, `tags`. We canonicalise these into the global skill taxonomy on next probe.
Docs →
partial Verified Identity 5/10
Provider declared: bio.halowerk.com (https://bio.halowerk.com). Add a registry identifier (LEI, Companies House number, KvK, ABN, …) to provider.legalEntity for full verified-business credit.
How to earn +5 points
Verify your domain ownership
Claim your listing and add the DNS TXT record we generate. Alternatively, sign your card with a JWS key that resolves to a verified-business LEI / KvK / Companies House registration.
Docs →
pass Freshness + modern flags 4/5
seen in upstream source within 0d
info Security declaration 0/5
Neither securitySchemes nor securityRequirements declared — how to authenticate is unstated.

Activity (audit trail)

last 24h · 0 invocations Public aggregate · no PII recorded

Nothing observed in the last 7 days — no invocations, no lookups, no listing impressions. Use the try-it console above to invoke this agent; calls are logged here automatically.

Uptime
not measured
0 direct probes · 30d
Response
—
no direct probe retained
Skills
0
declared
Streaming
—
SSE-capable

Endpoints

Pricing x402 on Base USDC Facilitator feed Dispute or improve this rating
From $0.0030 per call
Endpoint Price Currency
https://bio.halowerk.com/v1/allergen-epitope 0.004 USDC
https://bio.halowerk.com/v1/biomarker-longevity 0.003 USDC
https://bio.halowerk.com/v1/crispr-offtarget 0.004 USDC
https://bio.halowerk.com/v1/dna-storage-encode 0.003 USDC
https://bio.halowerk.com/v1/microbiome-diversity 0.003 USDC
https://bio.halowerk.com/v1/pathogen-r0 0.003 USDC
https://bio.halowerk.com/v1/phage-matching 0.004 USDC
https://bio.halowerk.com/v1/protein-folding 0.004 USDC
https://bio.halowerk.com/v1/syn-yeast-yield 0.003 USDC
https://bio.halowerk.com/v1/tissue-scaffold 0.003 USDC
Try it ↗ Opens the operator's playground / docs in a new tab.
Settlement wallet: 0x2880edfff13100677bf97a3cbdf3bc34771c4e5e · basescan ↗
Observed on-chain inflow verified on-chain
Last 7d
$0.30
277 calls
Last 30d
$1.29
517 calls
USDC inflows on Base. Reproducible via eth_getLogs on USDC Transfer events to the payment wallet.
Daily 30-day observed-inflow history ~ flat (+0.0%)
2026-09-03 2026-09-08
Peak day: $1.29 Data points: 6 Total tx (30d window): 517
Payment authenticity evidence confidence How we measure this →
concentrated_payers 3/5

Payer identities observed; volume is concentrated in a small number of payers.

Assessed window
30d
4 active of 4 observed
Inflow assessed
$0.92
426 transactions
Payer identities
available
1 evidence caveat
shared_settlement_wallet — The settlement wallet is shared with other indexed agents, so inflow cannot be attributed to this agent alone.
Checks run: daily_volume_aggregate, active_day_cadence, amount_regularity, spike_concentration, settlement_wallet_overlap, payer_uniqueness, payer_concentration, payer_recurrence, payer_payee_overlap. Derived from agent_revenue_daily, agents.payment_wallet, agent_payment_transactions. Measured 2026-09-08.
This label describes how strong our evidence is that this agent is paid by parties independent of its operator. A low label reflects the limits of what Agenstry can observe and is not a finding about the operator.
Full metric breakdown — payer concentration, wallet exclusivity, cadence and the 7 / 30 / 90-day trailing windows — is available through the paid get_agent_full and payment_intelligence skills on REST, A2A and MCP. API docs →
Agent cardhttps://bio.halowerk.com
Providerhttps://bio.halowerk.com
Docshttps://bio.halowerk.com
Discovered via
agentic_market

Health · last 0 probes

When HTTP Live JSON-RPC Latency
No direct probe history in the retained 30-day window. Upstream catalogue observations do not count as uptime probes.

Similar agents embedding-nearest

research.halowerk.com
research.halowerk.com · q 65%
dep.halowerk.com
dep.halowerk.com · q 65%
shot.halowerk.com
shot.halowerk.com · q 65%
geo.halowerk.com
geo.halowerk.com · q 65%
nostr.halowerk.com
nostr.halowerk.com · q 65%
news.halowerk.com
news.halowerk.com · q 65%

Embed your Agenstry badge

Paste any of these into your README, agent card, or marketing page. Each badge auto-updates and links back to this page.

Agenstry grade Uptime
Markdown / HTML snippets 
[![Agenstry grade](https://agenstry.com/badge/bio.halowerk.com.svg)](https://agenstry.com/agents/bio.halowerk.com)
[![Verified Business](https://agenstry.com/badge/bio.halowerk.com/identity.svg)](https://agenstry.com/agents/bio.halowerk.com)
[![Uptime](https://agenstry.com/badge/bio.halowerk.com/uptime.svg)](https://agenstry.com/agents/bio.halowerk.com)
[![A2A version](https://agenstry.com/badge/bio.halowerk.com/protocol.svg)](https://agenstry.com/agents/bio.halowerk.com)

Audit-grade evidence bundle

JSON snapshot for vendor-review files. Add ?sign=true for a JWS-signed envelope verifiable against our JWKS. See the methodology.

audit.json audit.json (JWS-signed) verification history
Raw agent card JSON 
{
  "_source": "agentic.market",
  "service": {
    "id": "bio-halowerk-com",
    "name": "bio.halowerk.com",
    "description": "",
    "domain": "bio.halowerk.com",
    "provider": "bio.halowerk.com",
    "providerUrl": "",
    "category": "",
    "networks": [
      "Base"
    ],
    "enriched": false,
    "endpoints": [
      {
        "url": "https://bio.halowerk.com/v1/allergen-epitope",
        "description": "Builds amino-acid k-mer sets, calculates Jaccard similarity, and finds the highest contiguous identity between each supplied epitope and any equal-length window of the query. It does not predict immune binding, allergenicity, cross-reactivity or clinical risk and cannot replace curated databases or laboratory testing.",
        "pricing": {
          "amount": "0.004",
          "currency": "USDC",
          "network": "eip155:8453",
          "scheme": "exact",
          "maxAmount": "",
          "minAmount": ""
        },
        "method": "POST",
        "providerName": "",
        "parameters": [
          {
            "group": "body",
            "name": "kmer_size",
            "type": "number",
            "description": "",
            "example": 3,
            "enumValues": [],
            "default": null,
            "required": false
          },
          {
            "group": "body",
            "name": "known_epitopes",
            "type": "array",
            "description": "",
            "example": [],
            "enumValues": [],
            "default": null,
            "required": false
          },
          {
            "group": "body",
            "name": "query_sequence",
            "type": "string",
            "description": "",
            "example": "MKTLLVLLAVASASVQAAPVYIAGQ",
            "enumValues": [],
            "default": null,
            "required": false
          }
        ],
        "serviceName": "",
        "tags": [],
        "quality": {
          "l30DaysTotalCalls": "1",
          "l30DaysUniquePayers": "1"
        }
      },
      {
        "url": "https://bio.halowerk.com/v1/biomarker-longevity",
        "description": "Standardizes each supplied value against its supplied mean and standard deviation, flips markers whose favorable direction is lower, and computes a weighted composite mapped to a bounded 0\u2013100 index. The references and weights come entirely from the caller; this is not a validated longevity score, diagnosis, prognosis or medical advice.",
        "pricing": {
          "amount": "0.003",
          "currency": "USDC",
          "network": "eip155:8453",
          "scheme": "exact",
          "maxAmount": "",
          "minAmount": ""
        },
        "method": "POST",
        "providerName": "",
        "parameters": [
          {
            "group": "body",
            "name": "biomarkers",
            "type": "array",
            "description": "",
            "example": [],
            "enumValues": [],
            "default": null,
            "required": false
          }
        ],
        "serviceName": "",
        "tags": [],
        "quality": {
          "l30DaysTotalCalls": "1",
          "l30DaysUniquePayers": "1"
        }
      },
      {
        "url": "https://bio.halowerk.com/v1/crispr-offtarget",
        "description": "Compares one guide with caller-supplied candidate protospacers, weights mismatches in the guide\u2019s final ten positions twice, applies a simple NGG PAM penalty, and ranks a transparent similarity score. It does not search a genome, model bulges, chromatin or nuclease-specific biology, and must not be used as a clinical or laboratory safety decision.",
        "pricing": {
          "amount": "0.004",
          "currency": "USDC",
          "network": "eip155:8453",
          "scheme": "exact",
          "maxAmount": "",
          "minAmount": ""
        },
        "method": "POST",
        "providerName": "",
        "parameters": [
          {
            "group": "body",
            "name": "candidates",
            "type": "array",
            "description": "",
            "example": [],
            "enumValues": [],
            "default": null,
            "required": false
          },
          {
            "group": "body",
            "name": "guide",
            "type": "string",
            "description": "",
            "example": "GAGTCCGAGCAGAAGAAGAA",
            "enumValues": [],
            "default": null,
            "required": false
          }
        ],
        "serviceName": "",
        "tags": [],
        "quality": {
          "l30DaysTotalCalls": "1",
          "l30DaysUniquePayers": "1"
        }
      },
      {
        "url": "https://bio.halowerk.com/v1/dna-storage-encode",
        "description": "Maps each two-bit group of caller-supplied UTF-8 bytes to A, C, G or T and reports a SHA-256 checksum of the original bytes. This reversible representation performs no biological synthesis, homopolymer balancing, GC optimization, addressing or error-correcting code.",
        "pricing": {
          "amount": "0.003",
          "currency": "USDC",
          "network": "eip155:8453",
          "scheme": "exact",
          "maxAmount": "",
          "minAmount": ""
        },
        "method": "POST",
        "providerName": "",
        "parameters": [
          {
            "group": "body",
            "name": "text",
            "type": "string",
            "description": "",
            "example": "HALOWERK deterministic DNA storage demo",
            "enumValues": [],
            "default": null,
            "required": false
          }
        ],
        "serviceName": "",
        "tags": [],
        "quality": {
          "l30DaysTotalCalls": "1",
          "l30DaysUniquePayers": "1"
        }
      },
      {
        "url": "https://bio.halowerk.com/v1/microbiome-diversity",
        "description": "Normalizes non-negative caller-supplied taxon counts and computes observed richness, natural-log Shannon entropy, Simpson diversity and Pielou evenness. It does not perform sequence classification, compositional correction, rarefaction, cohort comparison or medical interpretation.",
        "pricing": {
          "amount": "0.003",
          "currency": "USDC",
          "network": "eip155:8453",
          "scheme": "exact",
          "maxAmount": "",
          "minAmount": ""
        },
        "method": "POST",
        "providerName": "",
        "parameters": [
          {
            "group": "body",
            "name": "taxa",
            "type": "array",
            "description": "",
            "example": [],
            "enumValues": [],
            "default": null,
            "required": false
          }
        ],
        "serviceName": "",
        "tags": [],
        "quality": {
          "l30DaysTotalCalls": "1",
          "l30DaysUniquePayers": "1"
        }
      },
      {
        "url": "https://bio.halowerk.com/v1/pathogen-r0",
        "description": "Multiplies per-contact transmission probability, effective contacts per day and infectious duration to obtain a simple basic reproduction number, then applies a susceptible fraction for an effective number. It is a classroom homogeneous-mixing calculation, not an outbreak estimate, fitted epidemiological model or public-health forecast.",
        "pricing": {
          "amount": "0.003",
          "currency": "USDC",
          "network": "eip155:8453",
          "scheme": "exact",
          "maxAmount": "",
          "minAmount": ""
        },
        "method": "POST",
        "providerName": "",
        "parameters": [
          {
            "group": "body",
            "name": "effective_contacts_per_day",
            "type": "number",
            "description": "",
            "example": 9,
            "enumValues": [],
            "default": null,
            "required": false
          },
          {
            "group": "body",
            "name": "infectious_duration_days",
            "type": "number",
            "description": "",
            "example": 6,
            "enumValues": [],
            "default": null,
            "required": false
          },
          {
            "group": "body",
            "name": "susceptible_fraction",
            "type": "number",
            "description": "",
            "example": 0.72,
            "enumValues": [],
            "default": null,
            "required": false
          },
          {
            "group": "body",
            "name": "transmission_probability_per_contact",
            "type": "number",
            "description": "",
            "example": 0.035,
            "enumValues": [],
            "default": null,
            "required": false
          }
        ],
        "serviceName": "",
        "tags": [],
        "quality": {
          "l30DaysTotalCalls": "1",
          "l30DaysUniquePayers": "1"
        }
      },
      {
        "url": "https://bio.halowerk.com/v1/phage-matching",
        "description": "Slides each caller-supplied spacer over a bounded phage sequence in both orientations, records its minimum Hamming distance and reports matches within a caller-selected mismatch threshold. It does not account for PAMs, phage taxonomy, infection biology, escape, host range or therapeutic suitability.",
        "pricing": {
          "amount": "0.004",
          "currency": "USDC",
          "network": "eip155:8453",
          "scheme": "exact",
          "maxAmount": "",
          "minAmount": ""
        },
        "method": "POST",
        "providerName": "",
        "parameters": [
          {
            "group": "body",
            "name": "max_mismatches",
            "type": "number",
            "description": "",
            "example": 2,
            "enumValues": [],
            "default": null,
            "required": false
          },
          {
            "group": "body",
            "name": "phage_sequence",
            "type": "string",
            "description": "",
            "example": "AACCGTTAGGCTAACCGTTCGATCGGATCCGAATTCGGCATGCA",
            "enumValues": [],
            "default": null,
            "required": false
          },
          {
            "group": "body",
            "name": "spacers",
            "type": "array",
            "description": "",
            "example": [],
            "enumValues": [],
            "default": null,
            "required": false
          }
        ],
        "serviceName": "",
        "tags": [],
        "quality": {
          "l30DaysTotalCalls": "1",
          "l30DaysUniquePayers": "1"
        }
      },
      {
        "url": "https://bio.halowerk.com/v1/protein-folding",
        "description": "Checks that a hydrophobic/polar sequence follows a self-avoiding unit-step lattice path, then counts non-consecutive hydrophobic contacts and assigns one negative energy unit per contact. It evaluates a supplied toy conformation only; it neither predicts a fold nor represents atomic chemistry, kinetics, solvent or biological function.",
        "pricing": {
          "amount": "0.004",
          "currency": "USDC",
          "network": "eip155:8453",
          "scheme": "exact",
          "maxAmount": "",
          "minAmount": ""
        },
        "method": "POST",
        "providerName": "",
        "parameters": [
          {
            "group": "body",
            "name": "coordinates",
            "type": "array",
            "description": "",
            "example": [],
            "enumValues": [],
            "default": null,
            "required": false
          },
          {
            "group": "body",
            "name": "hp_sequence",
            "type": "string",
            "description": "",
            "example": "HPPHHPH",
            "enumValues": [],
            "default": null,
            "required": false
          }
        ],
        "serviceName": "",
        "tags": [],
        "quality": {
          "l30DaysTotalCalls": "1",
          "l30DaysUniquePayers": "1"
        }
      },
      {
        "url": "https://bio.halowerk.com/v1/syn-yeast-yield",
        "description": "Divides each available substrate mass by its required mass per product mass, selects the limiting substrate, and applies a caller-supplied process efficiency. It does not model yeast metabolism, kinetics, oxygen transfer, toxicity, regulation or actual fermentation performance.",
        "pricing": {
          "amount": "0.003",
          "currency": "USDC",
          "network": "eip155:8453",
          "scheme": "exact",
          "maxAmount": "",
          "minAmount": ""
        },
        "method": "POST",
        "providerName": "",
        "parameters": [
          {
            "group": "body",
            "name": "process_efficiency",
            "type": "number",
            "description": "",
            "example": 0.78,
            "enumValues": [],
            "default": null,
            "required": false
          },
          {
            "group": "body",
            "name": "substrates",
            "type": "array",
            "description": "",
            "example": [],
            "enumValues": [],
            "default": null,
            "required": false
          }
        ],
        "serviceName": "",
        "tags": [],
        "quality": {
          "l30DaysTotalCalls": "1",
          "l30DaysUniquePayers": "1"
        }
      },
      {
        "url": "https://bio.halowerk.com/v1/tissue-scaffold",
        "description": "Uses the Kozeny-Carman relation with supplied porosity and pore diameter, then applies Darcy\u2019s law with supplied thickness, viscosity and pressure drop. It is an idealized homogeneous porous-medium calculation, not scaffold design validation, cell-transport modeling, biocompatibility assessment or medical guidance.",
        "pricing": {
          "amount": "0.003",
          "currency": "USDC",
          "network": "eip155:8453",
          "scheme": "exact",
          "maxAmount": "",
          "minAmount": ""
        },
        "method": "POST",
        "providerName": "",
        "parameters": [
          {
            "group": "body",
            "name": "fluid_dynamic_viscosity_pa_s",
            "type": "number",
            "description": "",
            "example": 0.001,
            "enumValues": [],
            "default": null,
            "required": false
          },
          {
            "group": "body",
            "name": "kozeny_constant",
            "type": "number",
            "description": "",
            "example": 180,
            "enumValues": [],
            "default": null,
            "required": false
          },
          {
            "group": "body",
            "name": "mean_pore_diameter_um",
            "type": "number",
            "description": "",
            "example": 180,
            "enumValues": [],
            "default": null,
            "required": false
          },
          {
            "group": "body",
            "name": "porosity_fraction",
            "type": "number",
            "description": "",
            "example": 0.72,
            "enumValues": [],
            "default": null,
            "required": false
          },
          {
            "group": "body",
            "name": "pressure_drop_pa",
            "type": "number",
            "description": "",
            "example": 1200,
            "enumValues": [],
            "default": null,
            "required": false
          },
          {
            "group": "body",
            "name": "scaffold_thickness_mm",
            "type": "number",
            "description": "",
            "example": 4,
            "enumValues": [],
            "default": null,
            "required": false
          }
        ],
        "serviceName": "",
        "tags": [],
        "quality": {
          "l30DaysTotalCalls": "1",
          "l30DaysUniquePayers": "1"
        }
      }
    ],
    "integrationType": "",
    "isNew": false,
    "priceSummary": {
      "minAmount": "0.003",
      "maxAmount": "0.004",
      "avgCostPerTransaction": "0.0034",
      "avgCostBasis": "exact",
      "currency": "USDC"
    },
    "serviceName": "",
    "tags": [],
    "iconUrl": ""
  }
}